Come help with intelligent design debate!

[Baron Scarpia]

http://apolyton.net/forums/showthread.p ... ost1920923

Lincoln is quite an intelligent creationist, although he is prone to being a rude ass at times. He is rather stubborn in his repitition of things, but is articulate enough that it becomes time-consuming to argue with him.

Anyway, he is stating this:

"Let’s assume that there is credible proof that a bee evolved from a type of house-fly. Now let’s see where the new information comes from. The DNA of both organisms is not like the contents of a hard drive (ala Provost Harrison). DNA in actual use is manipulated by the machinery of transcription and translation. For example I proposed an order of DNA previously such as:

AGCTTCCGAATCGTAAGCCTAGCT

Now let’s assume that the fly takes the first word (AGC) and puts it to efficient use. Now even in a fly the manipulation of DNA is such that what is called a “frame shift” can occur intentionally. For example the living mechanism can select the “word” GCT and ignore the first A. So in other words there is an extreme potential in even a simple animal for change. All the machinery has to do is select whatever codon word that is useful at a particular time. Also, whole “sentences” can be excised from the string of DNA. This is all part of the normal function of the information contained in all life. Now let’s assume that the fly evolves into a bee.

Where did the new information come from? Well, it certainly could have been in the original DNA couldn’t it? All it really takes is a selection of DNA letters and the proper excising of it and you can theoretically produce almost anything, just as you can select from the information I have typed here and produce something entirely different that what I just said. Simply cut out the letters and words and parts of words and see what I mean as you past them together in another order altogether. This is exactly what even the normal operation of life entails. So the potential for evolution is there regardless of the addition of new information by whatever means.

So let’s move this to a computer. My spell checker gives me new information. It informs me when a word is misspelled. So where does this new information come from? Did it arise randomly? Well in a way it did because there was no intelligent input when it informed me of the misspelled word. IT just did it on it’s own. But wait, is that true? No, of course not because the program was the result of an intelligent programmer. He allowed for the manipulation of the initial information that he programed in by way of his own intelligence. But you can prove that I am wrong simply by producing a spell check program without the aid of an intelligent being. Try it.

Therefore, there is no reason to presume that evolution has ever produce new information ever. There is no evidence to back up that assertion. Now obviously a modern organism has the potential to deal with intrusions (such as mutations or a destructive virus). Is the present reality the result of a continuing increase in information by way of mutation and natural selection? Of course not. No one proposes that evolution works that fast. The initial information allowed for the intrusion or it is manipulated because of a currently operating system to deal with the intrusion. No further input of information from an outside source is necessary. The information contained in a virus is compared within the organism and it is dealt with just as my spell checker automatically deals with everything it was prepared for.

The idea that information that is produced by the accident of mutation, and this string of accidents causes creatures to evolve from a worm-like creature to a giraffe or whatever is absurd. A frog has the potential to transform itself from a tadpole to a frog. A caterpillar has the potential to turn into a butterfly. There is no necessity to speculate about accidental mutations at all, is there?

So, to simply state that evolution proves that information arises randomly is a stretch to say the least. The best way to prove that it does arise randomly is to actually show that it does."


Any debate?

[Cyborg Stan]

Bacteria can gain new resistances to antibiotics and DNA comparsions often show the resulting DNA is larger than the first. It works fast because bacteria have a high reproductive frequency and even then you have a bunch of dead bacteria before something happens.

New information can arise by having the gene duplicated and the copy modified.

[Joe]

Where did the new information come from? Well, it certainly could have been in the original DNA couldn?t it? All it really takes is a selection of DNA letters and the proper excising of it and you can theoretically produce almost anything, just as you can select from the information I have typed here and produce something entirely different that what I just said. Simply cut out the letters and words and parts of words and see what I mean as you past them together in another order altogether. This is exactly what even the normal operation of life entails. So the potential for evolution is there regardless of the addition of new information by whatever means.

The new information comes from mutation.

So let?s move this to a computer. My spell checker gives me new information. It informs me when a word is misspelled. So where does this new information come from? Did it arise randomly? Well in a way it did because there was no intelligent input when it informed me of the misspelled word. IT just did it on it?s own. But wait, is that true? No, of course not because the program was the result of an intelligent programmer. He allowed for the manipulation of the initial information that he programed in by way of his own intelligence. But you can prove that I am wrong simply by producing a spell check program without the aid of an intelligent being. Try it.

False analogy. The correction mechanism of evolution is something that occurs naturally, through natural selection; natural selection ensures that biological mistakes are wiped out, while beneficial mistakes (or mutations) increase the likelihood that an organism will survive.

This is just a long-winded divine fallacy. "I cannot explain this, therefore God."

Therefore, there is no reason to presume that evolution has ever produce new information ever. There is no evidence to back up that assertion. Now obviously a modern organism has the potential to deal with intrusions (such as mutations or a destructive virus). Is the present reality the result of a continuing increase in information by way of mutation and natural selection? Of course not. No one proposes that evolution works that fast. The initial information allowed for the intrusion or it is manipulated because of a currently operating system to deal with the intrusion. No further input of information from an outside source is necessary. The information contained in a virus is compared within the organism and it is dealt with just as my spell checker automatically deals with everything it was prepared for.

This reeks of Darkstar. What is so difficult to understand about mutations creating new biological information, over time, through a natural self-correcting process? Long-winded bullshit.

The idea that information that is produced by the accident of mutation, and this string of accidents causes creatures to evolve from a worm-like creature to a giraffe or whatever is absurd. A frog has the potential to transform itself from a tadpole to a frog. A caterpillar has the potential to turn into a butterfly. There is no necessity to speculate about accidental mutations at all, is there?

Why? Those accidents make organisms more equipped for surivival, and thus more likely to pass on their mutations to offspring. It takes a LONG time for this to happen, but that doesn't change the fact that it happens.

So, to simply state that evolution proves that information arises randomly is a stretch to say the least. The best way to prove that it does arise randomly is to actually show that it does.

Mutations are new information. What part of this does he not understand?

[AdmiralKanos]

http://apolyton.net/forums/showthread.p ... ost1920923

Lincoln is quite an intelligent creationist, although he is prone to being a rude ass at times. He is rather stubborn in his repitition of things, but is articulate enough that it becomes time-consuming to argue with him.

Anyway, he is stating this:

"Let’s assume that there is credible proof that a bee evolved from a type of house-fly. Now let’s see where the new information comes from. The DNA of both organisms is not like the contents of a hard drive (ala Provost Harrison). DNA in actual use is manipulated by the machinery of transcription and translation. For example I proposed an order of DNA previously such as:

AGCTTCCGAATCGTAAGCCTAGCT

Now let’s assume that the fly takes the first word (AGC) and puts it to efficient use. Now even in a fly the manipulation of DNA is such that what is called a “frame shift” can occur intentionally. For example the living mechanism can select the “word” GCT and ignore the first A. So in other words there is an extreme potential in even a simple animal for change. All the machinery has to do is select whatever codon word that is useful at a particular time. Also, whole “sentences” can be excised from the string of DNA. This is all part of the normal function of the information contained in all life. Now let’s assume that the fly evolves into a bee.

Where did the new information come from? Well, it certainly could have been in the original DNA couldn’t it? All it really takes is a selection of DNA letters and the proper excising of it and you can theoretically produce almost anything, just as you can select from the information I have typed here and produce something entirely different that what I just said. Simply cut out the letters and words and parts of words and see what I mean as you past them together in another order altogether. This is exactly what even the normal operation of life entails. So the potential for evolution is there regardless of the addition of new information by whatever means.

He's a dumb-ass. Gene duplication and alteration is common. So in his analogy, you go from AGCTTCCGAATCGTAAGCCTAGCT to AGCTTCCGAATCGTAAGCCTAGCTAGCT (note the duplication at the end). Subsequent generations alter this last part, and presto! New information.

So let’s move this to a computer. My spell checker gives me new information. It informs me when a word is misspelled. So where does this new information come from? Did it arise randomly? Well in a way it did because there was no intelligent input when it informed me of the misspelled word. IT just did it on it’s own. But wait, is that true? No, of course not because the program was the result of an intelligent programmer. He allowed for the manipulation of the initial information that he programed in by way of his own intelligence. But you can prove that I am wrong simply by producing a spell check program without the aid of an intelligent being. Try it.

False analogy. The "spell-check" in nature is survival or death, and no "intelligent design" is necessary to differentiate between those which die and those which survive. The asteroid impact 65 million years ago, for example, wiped out the larger life forms with the more extensive food requirements and therefore less robust life cycle; was this an "intelligent" process? Of course not; it was a simple natural process of selection.

Therefore, there is no reason to presume that evolution has ever produce new information ever. There is no evidence to back up that assertion.

Gene duplication has been observed. Gene alteration has been observed. Put those together and you get new information. Tell him he's a dumb-ass.

Now obviously a modern organism has the potential to deal with intrusions (such as mutations or a destructive virus). Is the present reality the result of a continuing increase in information by way of mutation and natural selection? Of course not. No one proposes that evolution works that fast.

Actually, that is precisely what we propose. Bacteria have an extremely fast reproductive cycle and can go through many generations quickly.

The initial information allowed for the intrusion or it is manipulated because of a currently operating system to deal with the intrusion. No further input of information from an outside source is necessary.

He doesn't understand the concept of evolution. Take a bacteria, with a natural pre-existing variation in characteristics which we express in the abstract form 34567. Expose a batch of this bacteria to an environment in which everything below 7 dies. Eventually, you won't just have 7, because of natural genetic variability. Through ongoing genetic mutation, you will have 6789 (for example). Meanwhile a second batch of the bacteria was exposed to an environment which kills off everything above 3. Eventually, you will have a sub-population with characteristics 1234. Presto, two populations with different characteristics. Rinse and repeat lots of times, and you eventually get two very different bacteria.

The information contained in a virus is compared within the organism and it is dealt with just as my spell checker automatically deals with everything it was prepared for.

Nice analogy. Too bad it bears no resemblance to the facts. There is no analysis algorithm built into the process. He has elevated this silly "spell checker" analogy in his mind until it represents the actual process through which natural selection occurs.

The idea that information that is produced by the accident of mutation, and this string of accidents causes creatures to evolve from a worm-like creature to a giraffe or whatever is absurd.

The appeal to personal judgement is not a valid argument.

A frog has the potential to transform itself from a tadpole to a frog. A caterpillar has the potential to turn into a butterfly. There is no necessity to speculate about accidental mutations at all, is there?

Obviously, he does not understand the distinction between Lamarkian evolution and Darwinian evolution. Sadly, a lot of critics of Darwinian evolution are still so woefully ignorant that they attack Lamarkian evolution instead of their true target, and then think they've scored a victory.

So, to simply state that evolution proves that information arises randomly is a stretch to say the least. The best way to prove that it does arise randomly is to actually show that it does."

Gene multiplication in reproduction has been OBSERVED. Gene mutation has been OBSERVED. Ergo, addition of information is obviously possible. This is common knowledge among even the most low-level biology student.

Any debate?

Maybe if he refrained from treating his false analogy as fact and confusing Darwinian evolution with Lamarkian evolution, there might be a possibility of debate. As it stands, he's just a long-winded blowhard.

[Baron Scarpia]

The crux of his argument is the "how can information come from randomness?" line:

"Where did the initial program come from? Where did the code, the translation, the grammar, the syntax, symantics etc. come from? That is the source of information not a mistake made in an already operating program. Where did the program come from?"

"There is no reason to assume that the ability of a bacteria to adapt so that it can "eat" something new that arises is the result of an accidental mutation. In fact that ability is more evidence for intelligent design."

"You keep nitpicking between abiogenesis and evolution. Use whatever process that you choose and produce information from randmoness. NOT more information from an already operating system. The problem is the system not the manipulation of an already established system."

[NecronLord]

Lincoln is quite an intelligent creationist,

[Brian Blessed]"HA! There's no such man!"[/Brian Blessed]

[Grand Moff Yenchin]

The crux of his argument is the "how can information come from randomness?" line:

This line is a clear point of his ignorance in not only evolution, but also biology.

"Where did the initial program come from? Where did the code, the translation, the grammar, the syntax, symantics etc. come from? That is the source of information not a mistake made in an already operating program. Where did the program come from?"

I'm smelling the 'monkeys typing Shakespeare' bullshit. One can check any scientific paper involved with protein research, the scientists often change nucleic acids in proteins for their experiments, and these recombinant proteins are often checked with the wild type, there are usually 3 outcomes: same function, different function, no function, all 3 can make some difference in an organism. There are actually a whole shitload of different grammar programs, not just one, and the ones preferred by customers 'survive', to counter even louder, there are different languages, and there might be new languages forming.

"There is no reason to assume that the ability of a bacteria to adapt so that it can "eat" something new that arises is the result of an accidental mutation. In fact that ability is more evidence for intelligent design."

This whole argument neglects natural selection, the last sentence is based on




(Thats right, nothing.)

"You keep nitpicking between abiogenesis and evolution. Use whatever process that you choose and produce information from randmoness. NOT more information from an already operating system. The problem is the system not the manipulation of an already established system."

What's this about? Mutilating the evolution in evolution?

[Ted C]

Now let’s assume that the fly evolves into a bee.

This one sentence sums up your opponent's misunderstanding of evolutionary theory.

A fly does not and can not evolve into a bee.

A population of flies can, over generations, evolve to produce more and more "bee-like" members. During these changes, mutation will add "words", remove "words", and change the spelling of "words" in the DNA string he's talking about. Furthermore, no two of the flies will have exactly the same string, just similar strings.

Over many more generations, if the "bee-like" population is successful and tends to reproduce within its own group, you might get a separate population of bees. Their DNA strings will have consistently changed from the original "fly" string. They may be longer, shorter, or significantly rearranged. No two "bee" strings will be exactly alike, but they will all have similar characteristics, and they will be clearly distinguishable from "fly" DNA strings.

Not that I think he's using a good set of organisms for analogy; I don't think that flies are ancestors of bees. Unless I'm mistaken, they're on separate branches of the "evolutionary tree" that diverged well before either family evolved.